Plant Genomic DNA and RNA Isolation Protocol

Genomic DNA was isolated from a single plant per accession from approximately 100 mg of dry leaf material using the Invisorb Plant Genomic DNA Isolation kit (Invisorb, Berlin, Germany) and standard protocol [52 (link),59 (link)]. Total RNA was isolated from young leaves using plant RNA kit (Macherey-Nagel, Düren, Germany). Isolated RNA was treated with DNaseI to remove genomic DNA. The accD gene was amplified directly from genomic DNA using primers (F1—GCATTAGTTTTCATTTTCAGTCC located 27 bp upstream of stop codon, R4—CTTTAATAGGGGTTTAGAATACA, located 94 bp upstream of ATG codon) [39 (link)]. We used cDNA as a template to avoid large intron sequences present in the bccp3 gene. One microgram of a total RNA was reversely transcribed with Oligo(dT) primer and AMV reverse transcriptase (Promega, Madison, USA) according to manufacturer´s protocol (Hradilová et al. 2017) [71 (link)]. Two step nested PCR amplification was used. After the first PCR (with primers F—CTAATGAAAGTGGCGGAAATC, R—CCTTATTACGCGTCTTAGTGAATG), the product was diluted (1:100) and the second PCR was performed (F33—CCATTCTCTGCACTCCCTTTCGCG, R1113—CAATTATTTCTCAATCTATTCAAAACG), using the conditions as described in Hradilová et al. [71 (link)]. PCR products were verified on a 1.5% agarose gel, treated with Exonuclease-Alkaline Phosphatase (Thermo Scientific, Brno, Czech Republic) and sequenced at Macrogene.