A basic schematic of the protocol used for performing GBS is shown in Figure 2 . Oligonucleotides comprising the top and bottom strands of each barcode adapter and a common adapter were diluted (separately) in TE (50 µM each) and annealed in a thermocycler (95°C, 2 min; ramp down to 25°C by 0.1°C/s; 25°C, 30 min; 4°C hold). Barcode and common adapters were then quantified using an intercalating dye (PicoGreen®; Invitrogen, Carlsbad, CA), diluted in water to 0.6 ng/µL (∼02 pmol/µL), mixed together in a 1∶1 ratio, and 6 µL (∼0.06 pmol each adapter) of the mix was aliquoted into a 96-well PCR plate and dried down. DNA samples (100 ng in a volume of 10 µL) were added to individual adapter-containing wells and plates were, again, dried.
Samples (DNA plus adapters) were digested for 2 h at 75°C with ApeKI (New England Biolabs, Ipswitch, MA) in 20 µL volumes containing 1× NEB Buffer 3 and 3.6 U ApeKI. Adapters were then ligated to sticky ends by adding 30 µL of a solution containing 1.66× ligase buffer with ATP and T4 ligase (640 cohesive end units) (New England Biolabs) to each well. Samples were incubated at 22°C for 1 h and heated to 65°C for 30 min to inactivate the T4 ligase. Sets of 48 or 96 digested DNA samples, each with a different barcode adapter, were combined (5 µL each) and purified using a commercial kit (QIAquick PCR Purification Kit; Qiagen, Valencia, CA) according to the manufacturer's instructions. DNA samples were eluted in a final volume of 50 µL. Restriction fragments from each library were then amplified in 50 µL volumes containing 2 µL pooled DNA fragments, 1× Taq Master Mix (New England Biolabs), and 25 pmol, each, of the following primers: (A)5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and (B) 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT . These primers contained complementary sequences for amplifying restriction fragments with ligated adapters, binding PCR products to oligonucleotides that coat the Illumina sequencing flow cell and priming subsequent DNA sequencing reactions [26] (link) (Figure 1 ).
Temperature cycling consisted of 72°C for 5 min, 98°C for 30 s followed by 18 cycles of 98°C for 30 s, 65°C for 30 s, 72°C for 30 s with a final Taq extension step at 72°C for 5 min. These amplified sample pools constitute a sequencing “library.” Libraries were purified as above (except that the final elution volume is 30 µL) and 1 µL was loaded onto an Experion® automated electrophoresis station (BioRad, Hercules, CA) for evaluation of fragment sizes. Libraries were considered suitable for sequencing if adapter dimers (∼128 bp in length) were minimal or absent and the majority of other DNA fragments were between 170–350 bp. If adapter dimers were present in excess of 0.5% (based on the Experion® output), libraries were constructed again using a few DNA samples and decreasing adapter amounts. Guidelines for adapting the protocol to different species including details for performing adapter titrations and are provided in Supporting Information (Text S1 , Figure S1 and Figure S2 ).
Once the appropriate quantity of adapters was empirically determined for a particular enzyme/species combination, no further adapter titration was necessary. Single-end sequencing (86 bp reads) of one 48- or 96-plex library per flowcell channel, was performed on a Genome Analyzer II (Illumina, Inc., San Diego, CA). See Bentley et al. [26] (link) for details of the sequencing process and chemistry.
Samples (DNA plus adapters) were digested for 2 h at 75°C with ApeKI (New England Biolabs, Ipswitch, MA) in 20 µL volumes containing 1× NEB Buffer 3 and 3.6 U ApeKI. Adapters were then ligated to sticky ends by adding 30 µL of a solution containing 1.66× ligase buffer with ATP and T4 ligase (640 cohesive end units) (New England Biolabs) to each well. Samples were incubated at 22°C for 1 h and heated to 65°C for 30 min to inactivate the T4 ligase. Sets of 48 or 96 digested DNA samples, each with a different barcode adapter, were combined (5 µL each) and purified using a commercial kit (QIAquick PCR Purification Kit; Qiagen, Valencia, CA) according to the manufacturer's instructions. DNA samples were eluted in a final volume of 50 µL. Restriction fragments from each library were then amplified in 50 µL volumes containing 2 µL pooled DNA fragments, 1× Taq Master Mix (New England Biolabs), and 25 pmol, each, of the following primers: (A)
Temperature cycling consisted of 72°C for 5 min, 98°C for 30 s followed by 18 cycles of 98°C for 30 s, 65°C for 30 s, 72°C for 30 s with a final Taq extension step at 72°C for 5 min. These amplified sample pools constitute a sequencing “library.” Libraries were purified as above (except that the final elution volume is 30 µL) and 1 µL was loaded onto an Experion® automated electrophoresis station (BioRad, Hercules, CA) for evaluation of fragment sizes. Libraries were considered suitable for sequencing if adapter dimers (∼128 bp in length) were minimal or absent and the majority of other DNA fragments were between 170–350 bp. If adapter dimers were present in excess of 0.5% (based on the Experion® output), libraries were constructed again using a few DNA samples and decreasing adapter amounts. Guidelines for adapting the protocol to different species including details for performing adapter titrations and are provided in Supporting Information (
Once the appropriate quantity of adapters was empirically determined for a particular enzyme/species combination, no further adapter titration was necessary. Single-end sequencing (86 bp reads) of one 48- or 96-plex library per flowcell channel, was performed on a Genome Analyzer II (Illumina, Inc., San Diego, CA). See Bentley et al. [26] (link) for details of the sequencing process and chemistry.
Free full text: Click here
