Gene Expression Analysis of AGR2 and XBP1

The cDNA template was prepared and amplified via PCR for 30 cycles at 95 °C for 15 s, 54 °C for 15 s, and 72 °C for 30 s (AGR2) or for 33 cycles at 95 °C for 15 s, 57 °C for 15 s, and 72 °C for 30 s (XBP1). 18S rRNA was used as an internal control. PCR products were examined via 2% agarose gel (Amresco, Solon, OH, USA) electrophoresis. The following primers were used: AGR2 Forward-5′ GAGCCAAAAAGGACACAAAGGA 3′, Reverse-5′ TGAGTTGGTCACCCCAACCT 3′; XBP1 Forward-5′ TTACGAGAGAAAACTCATGGCC 3′, Reverse-5′ GGGTCCAAGTTGTCCAGAATGC 3′. 18S rRNA Forward-5′ GCAGCTCACCTACCTGGAGAAATA 3′, Reverse-5′ TGCGTGTGTGGGTCTTTGAA 3′.