Silencing PI3KCA in Colorectal Cancer

We designed and synthetized the PI3KCA-shRNA as follows: shRNA (GCATTAGAATTTACAGCAAGA). The target vector pLVX-shRNA2 (Clontech Co. CA, US) was digested by BamHI and EcoRI. According to the study of Dang et al,20 (link) the shRNA vector was constructed and transfected into HT-29 and HCT-116 cells by Liposomes 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. The transfection efficiency for HT-29 and HCT-116 cells was 81% and 85%, respectively. Forty-eight hours after transfection, the cells were collected for RT-PCR, Western blotting analysis, and other assays.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Yang F., Gao J.Y., Chen H., Du Z.H., Zhang X.Q, & Gao W. (2017). Targeted inhibition of the phosphoinositide 3-kinase impairs cell proliferation, survival, and invasion in colon cancer. OncoTargets and therapy, 10, 4413-4422.

Publication 2017

pLVX-shRNA2

Assays Cells Ecori Hct 116 cells Ht 29 Liposomes Rt pcr Shrna Transfection Vector Western blotting analysis

Corresponding Organization :

Other organizations : Jinan Central Hospital, Weifang Medical University, Taishan Medical University

Top 5 similar protocols

Variable analysis

independent variables

Transfection of PI3KCA-shRNA into HT-29 and HCT-116 cells

dependent variables

PI3KCA gene expression (measured by RT-PCR)
PI3KCA protein expression (measured by Western blotting)

control variables

Transfection efficiency (81% for HT-29 cells, 85% for HCT-116 cells)
Transfection method (Liposomes 2000 from Thermo Fisher Scientific)

positive controls

Not explicitly mentioned

negative controls

Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!