RT-qPCR Gene Expression Quantification

RT-qPCR assays were performed following the previously published protocol (64 (link)). Total RNAs from harvested cells were extracted using the NucleoSpin RNA extraction kit (Cat. # 740955.250, MACHEREY-NAGEL), and 0.4–1 μg RNA was reversely transcribed using the iScript^™ cDNA Synthesis Kit (Cat. # 1708890, Bio-Rad). Real-time qPCR was conducted using the iTaq^™ Universal SYBR® GreenSupermix (Cat. # 1727125, Bio-Rad). The PCR reaction was performed on a Bio-Rad CFX connect qPCR machine under the following conditions: 95 °C for 10 m, 50 cycles of 95 °C for 15 s, and 60 °C for 1 m. Relative gene expression was normalized to GAPDH internal control as the 2^−ΔΔCt method: 2 ^{(ΔCT of targeted gene - ΔCT of GAPDH)}. The following primers were used. IL-4 forward: 5’-GTTCTACAGCCACCATGAGAA-3’, reverse: 5’-CCGTTTCAGGAATCAGATCA-3’; IL-6 forward: 5’-ACTCACCTCTTCAGAACGAATTG-3’, reverse: 5’-CCATCTTTGGAAGGTTCAGGTTG-3’(30 ); IL-8 forward: 5’-CTTGGCAGCCTTCCTGATTT-3’; reverse: 5’-GGGTGGAAAGGTTTGGAGTATG-3’; Nsp14 forward: 5’-CGGAAACCCAAAGGCTATCA-3’, reverse: 5’-TGTGGGTAGCGTAAGAGTAGAA-3’; IMPDH2 forward: 5′-CTCCCTGGGTACATCGACTT-3′, reverse: 5′-GCCTCTGTGACTGTGTCCAT-3′(64 (link)); GAPDH forward: 5′-GCCTCTTGTCTCTTAGATTTGGTC-3′, reverse: 5′-TAGCACTCACCATGTAGTTGAGGT-3′. SARS-CoV-2-TRS-L (N sgRNA forward): CTCTTGTAGATCTGTTCTCTAAACGAAC, SARS-CoV-2-TRS-N (N sgRNA reverse):GGTCCACCAAACGTAATGCG(65 (link))