Quantification of BDNF Expression in Rat Cortex

The peri-infarct regions of cortex of four rats in each group were collected on day 3 and day 7 of HT treatment. Total RNA was extracted from tissues by Trizol Reagent (Invitrogen Life Technologies). Total RNA was reversely transcribed to cDNA using the AMV First Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China). PCR amplification was performed in 20 μL containing 1 μL of each primer and 10 μL SybrGreen RT-PCR Master Mix (Toyobo, Osaka, Japan). The amplification procedure was performed at 95 °C for 3 min followed by 40 cycles of amplification reactions at 95 °C for 15 s and 60 °C for 40 s. The primers used included BDNF (185 bp): forward, 5′ TGGGGTTAGGAGAAGTCAAGC 3′, reverse, 5′ TGTTTCACCCTTTCCACTCCT 3′; β-actin (163 bp): forward, 5′ CGTAAAGACCTCTATGCCAACA 3′, reverse, 5′ AGCCACCAATCCACACAGAG 3′. β-Actin cDNA was used as a control. Relative expression between a given sample and a reference sample was calculated using the 2^–ΔΔCt method [22 (link)].