Hi-C Library Enrichment and Amplification
Corresponding Organization :
Other organizations : Breast Cancer Now, Institute of Cancer Research, London School of Hygiene & Tropical Medicine, Babraham Institute, University of Leicester
Variable analysis
- Modifications to the SureSelect protocol for target enrichment
- Yield of total DNA after pre-hybridisation and post-hybridisation PCR amplification and purification
- SureSelect protocol (Agilent, Santa Clara, CA, USA)
- Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) for PCR amplification
- Agencourt Ampure XP beads (Beckman Coulter, Brea, CA, USA) for purification
- Pre-hybridisation PCR primers: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T and CTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T
- Post-hybridisation PCR primers to the paired-end adaptors as described in Belton and colleagues
- Positive control: Not specified
- Negative control: Not specified
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!