Hi-C Library Enrichment and Amplification

Target enrichment was performed based on the SureSelect protocol (Agilent, Santa Clara, CA, USA), but incorporating the following modifications: (i) Biotinylated Hi-C di-tags bound to streptavidin beads were amplified pre-hybridisation directly from beads using 24 parallel 25 µl PCR reactions with five to eight cycles using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and pre-hybridisation PCR primers: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T and CTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T. PCR products were pooled and purified using Agencourt Ampure XP beads (Beckman Coulter, Brea, CA, USA) to yield ~750–1300 ng total DNA. 750 ng of library DNA was dried using a speedvac concentrator then resuspended in 3.4 µl of water. (ii) Enriched fragments were amplified post-hybridisation again directly from the streptavidin beads, using 18 parallel 25 µl reactions of five to eight cycles of PCR. PCR products were again pooled and purified using Agencourt Ampure XP beads (Beckman Coulter, Brea, CA, USA). Post-hybridisation PCR primers to the paired-end adaptors were as described in Belton and colleagues^{52 (link)}