Quantification of mRNA and miRNA Expression

RNA was collected using RNeasy Mini Kit (QIAGEN). For mRNA quantification, the TruScript Reverse Transcriptase (#NGB-54440, Norgen Biotek, Canada) was used to reverse the total RNA to cDNA. Subsequently, RT-qPCR were performed by using real-time PCR 7500 (#4351104, Thermofisher, Singapore). For miRNA quantification, the miRNA first strand Cdna synthesis kit (PC4801, Aidlab Biotechnologies, China) was used to reverse the total RNA to cDNA. Real-time quantitative PCR was performed using the miRNA-Real Time PCR Assay kit (PC4901, Aidlab Biotechnologies, China). The primers (5’-3’) were: IL-1β F: ACTGAGGACGTTCACCGTCTA, R GTGGGTGAATCTTAACTGGTT; miR-146a-5p F: CTGAGAACTGAATTCCATGGGTT, R GTGCAGGGTCCGAGGT; GAPDH F: TCCACGGTAAGCGGCATATGCTCT, R GCGCATTACCACGAACTCCATTCA; U6 F: CTTGCATCCGCATCAGA, R AATGCATCATGAAGTTCCGA. The internal controls were GADPH and U6. Gene fold change was calculated by 2^−ΔΔCt [15 (link)].