Reliable GSTA1 Genotyping Method
Corresponding Organization : University Hospital of Geneva
Other organizations : University of Geneva, SIB Swiss Institute of Bioinformatics
Protocol cited in 1 other protocol
Variable analysis
- Forward GSTA1-F-1336BP 5′-
TGGATCCCTCAGTTTTGTAAGG -3′ and reverse GSTA1-R-1336BP 5′-TAAACGCTGTCACCGTCC -3′ oligos
- GSTA1 genotype
- Platinum SuperFi II PCR Master Mix (ThermoFisher, USA)
- Cycling conditions: initiation for 3 min at 95 °C followed by 38 cycles at 95 °C for 30 s, 64 °C for 30 s and 72 °C for 45 s
- Forward and reverse PCR primers for Sanger sequencing
- TOPO TA cloning using linearized pMiniT 2.0 vector (E1202S, New England Biolabs, USA)
- E. coli NightSeq Sanger sequencing service (Microsynth, Switzerland)
- Validated on a patient showing ambiguous genotype from Ansari et al. cohort
- Validated on eight 1000 Genomes Project samples
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!