Engineered T7 RNAP Selection System

The vectors were constructed with Gibson assembly (NEB) or ClonExpress II One Step Cloning (Vazyme, Nanjing) kits. PCRs were carried out with PrimeSTAR Max (Takara) or Q5 (NEB) following the manufacturers' instructions. Accessory plasmids (Esvelt et al, 2011 (link)) for T7 RNAP evolution contained, in order, an rrnB terminator, the promoter of interest, a strong RBS 5′‐AAGGAGGAAAAAAAATATATAATG‐3′ where underlined bases represent the start codon, gIII, either the combination of aadA gene conferring spectinomycin resistance and pUC origin for a high‐copy version or bla gene conferring carbenicillin resistance and SC101 origin for a low‐copy version. Reporter plasmids were identical to SC101 accessory plasmids except for the replacement of gIII by gfp. T7 RNAP selection phage (Esvelt et al, 2011 (link); Wu et al, 2021 (link)) was constructed by replacing all but the last 202 bp of gIII with the gene encoding T7 RNAP in M13K07 (NEB) helper phage and then removing the p15a origin of replication and aph gene to restore the M13 origin of replication. The mutagenesis plasmid (Esvelt et al, 2011 (link); Badran & Liu, 2015 (link)) contained dnaQ926, dam, and seqA under control of psp operon. Information about plasmids used in the study is listed in Appendix Table S4.