PCR-based screening of targeted ROSA26 ES cell clones was performed using the external G1for primer (TAGGTAGGGGATCGGGACTCT) and the internal G2rev primer (GCGAAGAGTTTGTCCTCAACC) to generate a 1.3-kb PCR fragment (Supplementary Figure 1A). PCR positive clones were confirmed by Southern blotting for 5′ integration using the 5′ external probe (550 bp) and BamH1 digests of genomic DNA (5.8-kb wt allele and 3.0 kb targeted allele). 3′ integration was confirmed using the 3′ external probe (800 bp) and Kpn1 digests (37-kb wt allele and 8.8-kb targeted allele). Both the 5′ and 3′ external Southern probes were generated and provided as a generous gift by Michael Taschner and Dr. Christine Hartmann (IMP, Vienna). An internal Neo probe was used with EcoRV digests to detect a single 4.0-kb ROSA26-targeted allele. For the MultiSite pCAGG promoter targeting experiments to the ROSA26 locus in the sense/anti-sense orientation double EcoRI/KpnI digests were performed and the 5′ external probe generated fragment lengths of 5 kb and 6 kb for targeted events for the anti-sense and sense orientation respectively and an 11-kb fragment for the non-targeted wild-type allele. Similarly, the 3′ external probe generated an 8.8-kb and 9-kb fragment for the anti-sense and sense orientation respectively for the targeted allele and an 11-kb fragment for the wild-type allele. An internal eGFP probe was used to generate a single 5-kb and 6-kb fragment for the anti-sense and sense orientation respectively indicative of single-copy integration.