ARPE19 (ATCC, Manassas, USA, Cat. No. CRL‐2302) cells were referred to CRISPR/Cas9‐mediated knock‐out of the SUMF1 gene to generate the ARPE19 SUMF1−/− cell line. The gRNA sequence was determined by using the CRISPOR online tool (http://crispor.tefor.net/crispor.py ; Concordet & Haeussler, 2018 (link)) and selected based on the lowest off‐target score. The gRNA with the 5′‐3′ sequence CCCTTGCGGGTTCTTGCGGCTGC was used in an “all‐in‐one” vector additionally encoding Cas9 linked to green‐fluorescent protein (Cas9‐GFP) (Sigma‐Aldrich, St. Louis, USA). Plasmid‐DNA was electroporated into ARPE19 cells using the Amaxa system and a nucleofection kit (Lonza, Basel, Switzerland, Cat. No. VCA‐1003) following the manufacturers' instructions. GFP‐positive cells were sorted by fluorescent‐activated‐cell‐sorting (FACS) into 96‐well plates. Single‐cell derived colonies were screened for deletion mutations in the SUMF1 gene after extraction of genomic DNA, amplification of the target region by PCR (forward primer hSUMF1KOup, 5′‐3′‐sequence: cagcgccaaagaagtacctg, reverse primer hSUMF1KOlow, 5′‐3′‐sequence: tcggaggaatcgatggagc), followed by Sanger sequencing using the same primers. A cell clone carrying a homozygous deletion in the SUMF1 gene (c.139delCG, p.Ala47GlyfsTer74) leading to a premature stop codon was selected and expanded. Cells of the respective clone were subjected to cell lysis, protein estimation, and Western Blot analysis as described above using a SUMF1 antibody (R&D Systems, Minneapolis, USA, Cat No AF3680) to verify absent FGE protein expression (Appendix Fig S12 ).
Free full text: Click here
