Targeted Knockdown of Nuclear Proteins

Lipofectamine RNAiMAX (Invitrogen) was used to transfect 10 nM dsRNA following manufacturers protocol. 48 h post transfection, cells were used for assays. To down regulate PREP1, a cocktail of two siRNAs were used (siRNA 607 = GAUUUCUGCAGUCGAUACA; siRNA 900 = CUCCCAGCUUCAGUUACAG)^{11 (link)}. To target LMNB1 10 nM siRNA duplexes of abx903005 (Abbexa Ltd LMNB1: GCAGACUUACCAUGCCAAA) was used. To target SUN1, a Mission siRNA (Sigma-Aldrich SASI_Hs01_00032809) with the sequence CAGCUAAAGUCAGAGCUGU was used. To target SUN2 a Mission siRNA (Sigma-Aldrich SASI_Hs01_00176980) with the sequence CUAUUCAGACGUUUUCACUU was used. An siRNA targeting firefly luciferase (CAUCACGUACGCGGAAUAC) was used as control in all experiments.