For the overexpression of endogenous targets, an activator protein composed of a catalytically inactive Cas9 protein (dCas9) fused to 10 tandem VP16 units (Long et al. 2015 (link)) was expressed from the ubiquitous promoter eft-3 (plasmid pIK312). In addition, we expressed an MS2-VP64 fusion protein, synthesized as a gBlock DNA fragment (Integrated DNA Technologies) from the ubiquitous promoter eft-3 (plasmid pIK303) as an attempt to potentiate activation efficiency (Konermann et al. 2015 (link)).
Extrachromosomal arrays were created containing 100 ng/µL pIK312 Peft-3::Cas9-VP160, 100 ng/µL pIK303 Peft-3::MS2-VP64, and 20 ng/µL Prab-3::mCherry coinjection marker. The injection mix targeting MINISAT1 contained two gRNAs, at 20 ng/µL each (MSAT1: [g]cggcaatttcggcaattgc) cloned into the pIK292 backbone. The injection mix targeting the minimal promoter in the control strain contained six gRNAs, at 20 ng/µL each [(G)TGCAAATTACGAGCGTTGT, (G)AAATTACGAGCGTTGTAGG, GTTGTAGGGGGCGGAGCGAT, GCGATAGGTCCTATAGGTTT, ATCATCATTCATTCATTCAT, and (G)TCCTCTTTCTGAGCTTCTC], cloned into the pIK292 backbone. Transgenic strains were established in an N2 background.
Extrachromosomal arrays were created containing 100 ng/µL pIK312 Peft-3::Cas9-VP160, 100 ng/µL pIK303 Peft-3::MS2-VP64, and 20 ng/µL Prab-3::mCherry coinjection marker. The injection mix targeting MINISAT1 contained two gRNAs, at 20 ng/µL each (MSAT1: [g]cggcaatttcggcaattgc) cloned into the pIK292 backbone. The injection mix targeting the minimal promoter in the control strain contained six gRNAs, at 20 ng/µL each [(G)TGCAAATTACGAGCGTTGT, (G)AAATTACGAGCGTTGTAGG, GTTGTAGGGGGCGGAGCGAT, GCGATAGGTCCTATAGGTTT, ATCATCATTCATTCATTCAT, and (G)TCCTCTTTCTGAGCTTCTC], cloned into the pIK292 backbone. Transgenic strains were established in an N2 background.
