Quantification of Schistosome Transporter Gene Expression

Total RNA was extracted as described [44] (link), using RNAqueous-4-PCR (Life Technologies) and subsequently treated with Turbo-DNAase (Life Technologies) according to the manufacturer's instructions. Two step qRT-PCR was employed to measure RNAi knockdown. First-Strand cDNA was synthesized using the SMARTer cDNA synthesis kit (Clontech, Mt. View, CA) and amplified using the Brilliant II SYBR green qRT-PCR Master kit (Agilent Technologies, Santa Clara, CA) on an Applied Biosystems 3500 Genetic Analyzer according to the manufacturer's recommendations (omitting the cDNA synthesis step). Primers used for the amplification of SMDR2, SmMRP1 and 18S ribosomal RNA have been described previously [43] (link), [44] (link). Primers used for amplification of ABCA4 (Smp_056290) were: ABCA4-Sy1 (5′- GGGTGGTATGACAACAGCAA -3′) and ABCA4-Sy2 (5′- GAGCTGAAATTGGCCCTCTA -3′). Primers used for amplification of ABCB6 (Smp_134890) were: ABCB6-Sy1 (5′- TGCTATTGCCGCTGACATAC -3′) and ABCB6-Sy2 (5′- CCAATGCTGATGTAGCTTCG -3′). Primers used for amplification of MRP7 (Smp_147250) were: MRP7-Sy1 (5′- AGCTGGTGGGAGCAGTCTTA -3′) and MRP7-Sy2 (5′- ATCCAACTGGTGTGTGACGA -3′). Data were analyzed using the 2^−ΔΔC_t method [83] (link) to determine the relative expression ratio between target (transporters) and reference genes (18S RNA).