Quantitative RNA Expression Analysis

RNA was isolated using the Isol-RNA lysis procedure (5 Prime, Hamburg, Germany). 25 μg of breast, kidney, liver and lung RNA of normal human samples (pools of five, one, three and four, respectively) were obtained from Agilent Technologies (Waldbronn, Germany). RNA was DNase (Fermentas GmbH, St.Leon-Rot, Germany) digested and then reversely transcribed [44 (link)]. RT-PCR was performed with primers: AATKRTF1: TGGCCTGGCTCACTGCAAGTACAG, AATKRTR1: CCCAGATGGTCACGCCCAGG, mAatkRTF1: GTGCTGAAGTGACCCCCTAC, mAatkRTR1: GGTCAGCGGTCACGAGATAG, ßACTFW: CCTTCCTTCCTGGGCATGGAGTC, ßACTRW: CGGAGTACTTGCGCTCAGGAGGA, GGCTCFRTFW: CAGGAAACGGAGGCTACGGTGG, GGCTCFRTRW: CCTCCTGCAGGCCTCCTTTGGA. Quantitative PCR (qRT-PCR) was performed in triplicate with PerfeCTa SYBR® Green (Quanta BioSciences, Gaithersburg, USA) using a Rotor-Gene 3000 (Corbett Research, Qiagen, Hilden, Germany).

Free full text: Click here

Haag T., Herkt C.E., Walesch S.K., Richter A.M, & Dammann R.H. (2014). The apoptosis associated tyrosine kinase gene is frequently hypermethylated in human cancer and is regulated by epigenetic mechanisms. Genes & Cancer, 5(9-10), 365-374.

Publication 2014

PerfeCTa SYBR® Green

Breast Dnase Gene Human Kidney Liver Lung Primers Rt pcr Sybr green

Corresponding Organization :

Other organizations : Universities of Giessen and Marburg Lung Center, German Center for Lung Research

Top 5 similar protocols

Protocol cited in 1 other protocol

Variable analysis

independent variables

RNA source (breast, kidney, liver, lung)

dependent variables

Gene expression measured by qRT-PCR

control variables

Normal human samples
RNA pooled from multiple individuals (5, 1, 3, 4 respectively)
RNA isolation method (Isol-RNA lysis procedure)
DNase digestion of RNA
Reverse transcription of RNA to cDNA
QRT-PCR reagents and equipment (PerfeCTa SYBR® Green, Rotor-Gene 3000)

controls

Positive control: Not explicitly mentioned
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!