The single‐guide RNAs (sgRNAs) used in this study were purchased from Integrated DNA Technologies (IDT). These modified sgRNAs contain 2′‐O‐methyl‐3′‐phosphorothioate modifications at the three terminal nucleotides of the 5′ and 3′ ends. Ribonucleoprotein (RNP) complexes were made by mixing 100 pmol sgRNA and 6 μg Cas9 nuclease V3 protein (IDT) in 5 μl Opti‐MEM (Gibco) for incubation at room temperature for 25 min before electroporation. SH‐SY5Y cells (300,000 cells) resuspended in 15 μl Opti‐MEM were mixed with the RNP complexes and subjected to electroporation using the Lonza 4D electroporator (program CM138). The gene knockout efficiency was validated by Western blotting. The sgRNA spacer sequences were as follows: AAVS1 sgRNA: 5′‐GGGGCCACUAGGGACAGGAU‐3′ GSDME sgRNA 1#: 5′‐AAGUCCGACUCCACGACCAC‐3′ GSDME sgRNA 2#: 5′‐CUCCUCCAUUCCAGUGGUCG‐3′ Caspase 2 sgRNA 1#: 5′‐UGUAGGAUAUUGGGAGUGUG‐3′ Caspase 2 sgRNA 2#: 5′‐UUUAGAGUUUCCUGAUGAUG‐3′ BiD sgRNA 1#: 5′‐UCAACAACGGUUCCAGCCUC‐3′ BiD sgRNA 2#: 5′‐GAUGCACUCAUCCCUGAGGC‐3′ Caspase 3 sgRNA 1#: 5′‐CUAAACAGAAAGAUCAUACA‐3′ Caspase 3 sgRNA 2#: 5′‐GGAAGCGAAUCAAUGGACUC‐3′ Caspase 7 sgRNA 1#: 5′‐GCCCUGAUCAUCUGCCAUCU‐3′ Caspase 7 sgRNA 2#: 5′‐UCCCAGAUGGCAGAUGAUCA‐3′ IFI16 sgRNA 1#: 5′‐ACUGACCACAAUCAACUGUG‐3′ TRIF sgRNA: 5′‐CGAAGGCGCUAGGAAGUGAU‐3′ MAVS sgRNA: 5′‐AGGUGGCCCGCAGUCGAUCC‐3′ MYD88 sgRNA: 5′‐CUGUCUCUUCCCCACAGAGG‐3′ STING sgRNA: 5′‐CAGUCCUCCAGUAGCUGCCC‐3′ IRE1α sgRNA 1#: 5′‐UUCAGGAAGCGUCACUGUGC‐3′ IRE1α sgRNA 2#: 5′‐CAGCGUUGACACAAACAACA‐3′.
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required