Identifying Induced Point Mutations in HSBP1

For the identification of induced point mutation in HSBP1, a TILLING platform based on Red Setter cultivar was used [46 (link)]. DNA amplification was performed using nested PCR with gene-specific primers (HSBP1-For-ext: GGCCCTTTAAAGAACTCTCTCTG, HSBP1-Rev-ext: ATAGGCGGGTGTAGGGTTCT, HSBP1-For-int: TTGGTTCAATTTTCATGCACTT, HSBP1-Rev-int: AAAAAGGCTATAAATTTTCTATTATTGC. Internal primers were 5’-end labeled with IRDye 700 and IRDye 800 dye (LI-COR, Lincoln, NE, USA), respectively. The PCR amplifications were carried out according to the experimental conditions described previously [47 (link)]. Mutation detection was performed by using Endonuclease ENDO I [48 (link)] and LI-COR 4300 DNA Analyzer (LI-COR, Lincoln, NE, USA). Adobe Photoshop software was used for image analysis (Adobe Systems Inc., San Jose, CA, USA). Mutation was validated by Sanger sequencing, and its position was defined at nt 761 from the first nucleotide of the amplicon generated by primers HSBP1-For-ext/HSBP1-Rev-ext. Prediction of the impact of amino acid change on protein function was done using SIFT software [49 (link)].