Hippocampal RNA Isolation and qPCR

RNA from whole hippocampus was isolated and reverse transcribed as previously described [23 (link)]. Briefly, brains were dissected, and samples were homogenized in Trizol according to manufacturer's instructions. RNA was precipitated and treated with one unit of DNase I (Life Technologies). Five micrograms of total RNA were reverse transcribed using random primers and ImProm II kit (Promega). cDNA was quantified by qPCR using Kapa SYBR Quantimix (Kapa). The qPCR analysis was performed in triplicates from one reverse transcribed product using the Rotor-Gene 6000 (Corbett). Values were analyzed following the 2^−ΔΔCt method using cyclophilin-A (Cyc) and β2-microglobulin (B2m) as normalization controls using the following primer pairs: Ryr3 F:TGGTGTCGGTGATGATCTGT and R:TGCACAGGTTGTCCATTGAT [4 (link), 20 (link)]; Cyc F:GGCAATGCTGGACCAAACACAA and R:GTAAAATGCCCGCAAGTCAAAAG; B2m F:GCTATCCAGAAAACCCCTCAA and R:CATGTCTCGATCCCAGTAGACGGT [23 (link), 24 (link)].