Total RNA from GMSCs was extracted by using TRIzol (Invitrogen). The levels of miR-4651 in GMSCs were detected by using a Hairpin-it microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, Suzhou, China). Two-microgram aliquots of RNA were reverse-transcribed into cDNA with random hexamers or oligo(dT) and reverse transcriptase according to the manufacturer’s instructions (Invitrogen). Then, real-time PCR was performed as previously described.54 (link) GAPDH and U6 were used to normalize mRNA and miRNA levels, respectively. Primer sequences are listed in Table 1.

Primers sequences used in the real-time RT-PCR

Gene symbolPrimer sequence (5′-3′)
GAPDH-FCGGACCAATACGACCAAATCCG
GAPDH-RAGCCACATCGCTCAGACACC
HMGA2-FACCCAGGGGAAGACCCAAA
HMGA2-RCCTCTTGGCCGTTTTTCTCCA
Free full text: Click here