Total RNA content was extracted from the tissues using TRIzol Reagent (Invitrogen, CA, USA) and was reverse transcribed into cDNA using the PrimeScript RT reagent Kit (TaKaRa, Tokyo, Japan) according to the manufacturer’s instructions. The relative expression levels of mRNA and circRNA (normalized to β-actin) were analysed by the 2−ΔCt relative quantification method, and the relative circRNA expression was calculated with the 2−ΔCt method [19 (link)]. qPCR was performed using a SYBR Green qPCR kit (TOYOBO, Tokyo, Japan) in the StepOne PCR system (Applied Biosystems). Primer sequences are shown in Table 1.

Primers used for qPCR analysis of circRNA and mRNA levels

TargetPrimer Sequence 5` to 3`
ForwardReverse
HIF1AGTCTGCAACATGGAAGGTATTGGCAGGTCATAGGTGGTTTCT
ACTBGAGAAAATCTGGCACCACACCGGATAGCACAGCCTGGATAGCAA
hsa_circ_0007798CCTGGAAGAGATGGATCAGAAAGCATGCACGGCAGAAATC
Free full text: Click here