Cells were cultured in DMEM+10% FBS in 100 mm tissue culture dishes until ∼70% confluence and then treated with DMSO alone or increasing concentrations of FH535 in DMSO for 38 h. For RNA analysis, cells were harvested and cDNA was prepared as described [21] (link). Quantitative PCR was carried out with SYBR green using the Bio-Rad MyiQ thermal cycler with the following primers: Survivin (BIRC5, CAAGGAGCTGGAAGGCTGG and GTTCTTGGCTCTTTCTCTGTCC ), Cyclin D1 (CCND1: GGATGCTGGAGGTCTGCGA and TAGAGGCCACGAACATGCAAGT ), and β2-microglobulin (B2M: GACTTTGTCACAGCCCAAGATAG and TCCAATCCAAATGCGGCATCTTC ).
Free full text: Click here
