RNA was isolated from tissues using Trizol extraction followed by purification with the Qiagen RNAeasy kit as described previously32 (link),33 (link). RNA-seq was performed by the Sequencing and Microarray Facility (SMF) core at MD Anderson. Libraries were generated using Illumina’s TruSeq kit and were sequenced using the Illumina HiSeq2000 Sequencer. Raw read RNA-seq data were mapped to the hg19 reference genome using Bowtie34 (link). The mapped reads were then assembled by Cufflinks35 (link)to generate a transcriptome assembly for each sample. After the assembly phase, Cufflinks quantified the expression of the transcriptome in each gene for each sample (that is, FPKM, fragments per kilobase of transcript per million fragments mapped). For qRT–PCR, RNA samples were reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcript kit (Life Technologies). cDNA samples were subjected to qRT–PCR quantification in duplicate and performed with Power SYBR Green PCR Master Mix (Invitrogen) according to the product guides on a Agilent Mx3005P and Applied Biosystems AB7500 Fast Real Time machine.
The primer sequences used for real-time qRT–PCR are the following: ME2 (Fwd 5′ ATTAGTGACAGTGTTTTCCTA 3′, Rev 5′ CTATTCTGTTATCACAGG 3′), BCAT2 (Fwd 5′ CTCTGGGGCAGCTGTTTGA 3′, Rev 5′ ATAACACCATTCAGCGGGGG 3′).
The primer sequences used for real-time qRT–PCR are the following: ME2 (Fwd 5′ ATTAGTGACAGTGTTTTCCTA 3′, Rev 5′ CTATTCTGTTATCACAGG 3′), BCAT2 (Fwd 5′ CTCTGGGGCAGCTGTTTGA 3′, Rev 5′ ATAACACCATTCAGCGGGGG 3′).
