Gene Expression Analysis by qRT-PCR

Cells were grown in triplicate on 12-well plates and treated as described in figure legends. Total RNA was harvested using TRI Reagent (Sigma-Aldrich), and reverse transcribed into cDNA using the SuperScript III First Strand cDNA Synthesis Kit (Life Technologies). mRNA levels were determined by qRT-PCR using SensiMix SYBR Green (Bioline) on a Corbett Rotorgene 3000 (Corbett Life Sciences, Sydney, Australia) using primers for IQGAP1 (F: AAGAAGGCATATCAAGATCGG, R: CCTCAGCATTGATGAGAGTC), ABCA1 [55 (link)], HMGCR [56 (link)] and the housekeeping gene, porphobilinogen deaminase, PBGD [55 (link)]. The mRNA expression levels were normalized to that of PBGD and made relative to the vehicle condition using the ΔΔCt method.