RNAPII ChIP experiments were performed using the ZymoSpin ChIP Kit (Zymo Research) according to instructions. A ChIP-grade anti-RNA-Polymerase II antibody (H-224, sc-9001, Santa Cruz Biotechnology) and as a control normal rabbit IgG (sc-2027, Santa Cruz Biotechnology) were used at concentrations of 2.5 µg/ChIP experiment. The sequences of the primer pairs for the detection of proRBM39 transcript occupancy were described before (Andersen et al. 2013 (link)) (proRBM39#1: fwd: GGGTGGAGAGGAAGTGGAAAAGTG, rev: CCCCTCTCCCCCTACCCCTAAAGA proRBM39#2: fwd: TGTGCCCCGAATTTAATCAGC, rev: TCAGGAAGGGGAACATTTTTGAA and proRBM39#4: fwd: AACAGCTAACTTCTGTTTCTGCT, rev: ACCTGAGAGGCAAAACCACT). Control primers detecting the RNA-Polymerase II occupancy of EGR1 were designed using the Primer3 online tool mentioned above: EGR1-1(fwd): CCGACACCAGCTCTCCAG, EGR1-2(rev): TCAGCAGCATCATCTCCTCC, EGR1-5(fwd): CAGTGGCCTAGTGAGCATGA, EGR1-6(rev): TTGTGGCTCAGGGAAAATGT. The combination EGR1-1/2 amplifies base pairs 239–394 and EGR1-5/6 the nucleotides 744–933 of human EGR1 (NM_001964.2).
Protocol detail
RNAPII Occupancy Profiling via ChIP
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : Medizinische Hochschule Hannover, Aarhus University, University of Dundee, MRC Protein Phosphorylation and Ubiquitylation Unit
Top 5 similar protocols
Variable analysis
independent variables
- ChIP experiments using the ZymoSpin ChIP Kit
- Anti-RNA-Polymerase II antibody (H-224, sc-9001, Santa Cruz Biotechnology)
- Normal rabbit IgG (sc-2027, Santa Cruz Biotechnology) as a control
- RNA-Polymerase II occupancy on the proRBM39 transcript
- RNA-Polymerase II occupancy on the EGR1 gene
- Concentration of antibodies used at 2.5 µg/ChIP experiment
- Positive control: Anti-RNA-Polymerase II antibody
- Negative control: Normal rabbit IgG
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!