Native ChIP-qPCR for Histone Modifications

Native chromatin immunoprecipitation was performed by following a previously published protocol (20 (link)). In brief, native chromatin prepared from 5 − 10 × 10⁶ cells was digested with micrococcal nuclease (Worthington) and subjected to immunoprecipitation using antibodies against H3K27ac (ab4729, Abcam) or H3K4me2 (ab7760, Abcam) coupled to Dynabeads protein G (Life Technologies). Precipitated DNA was purified and enrichment of the Cd4 regulatory regions was quantitated by real-time PCR with the following primers using a Roche LC480II and Luminaris Color SYBR green PCR reagent (Thermofisher):

Cd4Sil-F: TACGAAGCTAGGCAACAGAGGAAG,

Cd4Sil-R: TGTGGTCCCGAATGCGTTT,

Tcrb-enhancer (Eβ)-F: GCTCCATCTCCAGGAGTCAC,

Eβ-R: AAGTGTGGTTCCCAAAATGC,

DHS+3-F: AAGGAGGAAGAGCCCAATAGAG,

DHS+3-R: TGTGTCAGTCCCTGGTGAGTAG.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Henson D.M., Chou C., Sakurai N, & Egawa T. (2014). A silencer-proximal intronic region is required for sustained CD4 expression in post-selection thymocytes. Journal of immunology (Baltimore, Md. : 1950), 192(10), 4620-4627.

Publication 2014

micrococcal nuclease ab4729 ab7760 Dynabeads protein G

Antibodies Cells Chromatin Chromatin immunoprecipitation Immunoprecipitation Micrococcal nuclease Primers Protein g Real time pcr Regulatory regions Sybr green Tcrb

Corresponding Organization : Washington University in St. Louis

Top 5 similar protocols

Variable analysis

independent variables

Antibody used for immunoprecipitation (H3K27ac or H3K4me2)

dependent variables

Enrichment of Cd4 regulatory regions measured by real-time PCR

control variables

Amount of cells used (5 - 10 × 10^6)
Micrococcal nuclease digestion of native chromatin
Dynabeads protein G used for immunoprecipitation

positive controls

Not explicitly mentioned

negative controls

Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!