Cas9 mRNA and single guide RNAs (sgRNAs) were synthesized as described previously [5 (link)34 (link)]. Briefly, Cas9 mRNA was prepared in vitro from linear DNA templates, using the mMESSAGE mMACHINE T7 Ultra Transcription Kit (Invitrogen, Carlsbad, CA, USA), and sgRNAs were generated using the MEGAshortscript T7 Transcription Kit (Invitrogen), both according to the manufacturer's instructions. The following sequences were used for sgRNA synthesis: left sgRNA, TTGAGACCTCGCATCGAAGATGG; right sgRNA, TGTGATTGCTTCAGTGACTGCGG.
Protocol detail
Cas9 mRNA and sgRNA Synthesis
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Mrna
Single guide rnas
Synthesis
Transcription
Corresponding Organization :
Other organizations : Yonsei University, Seoul National University Hospital, Seoul National University
Top 5 similar protocols
Variable analysis
independent variables
Cas9 mRNA- Single guide RNAs (sgRNAs)
- Not explicitly mentioned
- Not explicitly mentioned
- No positive or negative controls are explicitly mentioned.
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!