The invasive E. coli strain SVC1 is a K‐12 derivative [F–endA1 hsdR17 (rK– mK+) glnV44 thi‐1 relA1 rfbD1 spoT1 Δrnc ΔdapA]. The cells are auxotrophic for diaminopimelic acid (DAP) due to a deletion of dapA. E. coli cells were cultured in brain–heart infusion medium supplemented with DAP (100 μg/mL) and appropriate antibiotics at the following concentrations: kanamycin, 25 μg/mL; ampicillin, 100 μg/mL. A549 cells are a human adenocarcinoma alveolar basal epithelial cell line. For the in vitro GFP silencing experiments, an A549 cell line constitutively expressing GFP (Cell Biolabs, San Diego, California, USA, AKR‐209) was used. The identity of the A549/GFP cells was confirmed by GFP expression, morphology, and trypan‐blue dye exclusion, and all cell cultures were routinely monitored for microbial contamination using standard techniques. The construction of pSiVEC‐scramble (non‐specific small RNA sequence), pSiVEC‐PA, and pSiVEC‐NP, which were derived from pmbv43 [8 (link)], is described in a previous publication [9 (link)]. pSiVEC‐GFP was constructed using the DNA template encoding the shRNA specific for GFP [77 (link)] from the copepod Pontellina plumata: sense, GCTACGGCTTCTACCACTTT and antisense, AAAGTGGTAGAAGCCGTAGC. Using standard cloning and transformation methods, resulting SVC1 colonies transformed with the plasmids pSiVEC‐scramble, pSiVEC‐PA, pSiVEC‐NP, and pSiVEC‐GFP were screened by PCR, and a single positive clone was sequence validated and propagated. Stocks were generated and stored at −80°C in 20% glycerol. A single frozen aliquot from each construct stock was thawed to determine colony forming units (CFU)/mL via plate enumeration [9 (link)]. These strains are referred to as SVC1‐scramble, SVC1‐PA, SVC1‐NP, and SVC1‐GFP.
Free full text: Click here
