The C5024T mutation level was determined as described previously from DNA isolated from ear clips around the timing of weaning [8 (link)]. Briefly, a 178-base pair fragment spanning the C5024T site was amplified using the primers 5′Biotin TTCCACCCTAGCTATCATAAGC (forward) and GTAGGTTTAATTCCTGCCAATCT (reverse). PCR products were purified using PyroMark binding buffer (Qiagen) and 1 μl Streptavidin Sepharose TM high-performance beads (GE Healthcare) and denatured with a Pyromark Q24 vacuum workstation (Qiagen). Sequencing was performed using the sequencing primer TGTAGGATGAAGTCTTACA and PyroMark Gold Q24 Reagents (Qiagen) according to the manufacturer’s instructions on a PyroMark Q24 pyrosequencer (Qiagen).
Free full text: Click here
