Quantifying ADE2 Transcript Levels in C. albicans

To monitor ADE2 transcript levels, qRT-PCR was performed as previously described (84 (link)). Briefly, C. albicans cells were grown overnight in YPD at 37°C, diluted to an OD₆₀₀ of 0.2, and grown to an OD₆₀₀ of ∼1.0 at 37°C. Cultures were then pelleted and frozen overnight at –80°C. RNA was isolated using a Geneaid yeast total RNA minikit supplemented with zymolyase. cDNA synthesis was performed using 800 ng RNA and a High Capacity cDNA reverse transcription kit (Applied Biosystems). PCR was performed using 2× PerfeCta SYBR green FastMix from Quanta BioScience under the following cycling conditions: 30 s at 95°C for the polymerase activation step, followed by 40 cycles of a two-step quantitative PCR (qPCR) procedure (3 s of 95°C denaturation, 30 s of 60°C combined annealing/extension). The primers used were as follows: for ADE2, TTAGTGTATGCTCCTGCCAGG and GAGTTGTGAGGTCTTGGTGC; for ACT1 (control), GTTGGTGATGAAGCCCAATCC and CTGGATGTTCTTCTGGAGCAAC.