Quantitative RT-PCR Analysis of Rice Protoplast Transcripts

Total RNA of rice protoplasts was extracted using the Omega Plant RNA kit according to the manufacturer's instructions. cDNA was made using the PrimeScript RT reagent Kit with gDNA eraser (Taraka) with 2 μg of total RNA as the template. Quantitative real-time PCR was performed with a Bio-Rad IQ5 system using SYBR to monitor double-stranded DNA products. The gene-specific primers were as follows: OsLhcb1 (Os09g0346500), 5' GGAAGATGGGTTTAGTGCG 3' and 5' GCTAATCAGAATAACACCACGG 3'; OsLhcp (Os01g0600900), 5' TACGAGTATTGGAGAGAGG 3' and 5' TAAGTAGCACGCAGGATT 3'; GADPH (Os03g0129300), 5' GTGGCCAACATTATCAGCAA 3' and 5' GGTCATGGTTCCCTTTACGA 3'; RbcS (Os12g0292400), 5' CCCGGATACTATGACGGTAGG 3' and 5' AACGAAGGCATCAGGGTATG 3'; β-actin (internal control), 5' CCTGACGGAGCGTGGTTAC 3' and 5' CCAGGGCGATGTAGGAAAGC 3'.

Free full text: Click here

Zhang Y., Su J., Duan S., Ao Y., Dai J., Liu J., Wang P., Li Y., Liu B., Feng D., Wang J, & Wang H. (2011). A highly efficient rice green tissue protoplast system for transient gene expression and studying light/chloroplast-related processes. Plant Methods, 7, 30.

Publication 2011

Actin Cdna Double stranded dna Gene Plant rna Primers Protoplasts Quantitative real time pcr Rbcs Rice

Corresponding Organization :

Other organizations : Sun Yat-sen University

Top 5 similar protocols

Protocol cited in 41 other protocols

Variable analysis

independent variables

Extraction of total RNA using the Omega Plant RNA kit
Synthesis of cDNA using the PrimeScript RT reagent Kit with gDNA eraser

dependent variables

Expression levels of the following genes: OsLhcb1, OsLhcp, GADPH, RbcS, and β-actin

control variables

Amount of total RNA used as template for cDNA synthesis (2 μg)
Use of the Bio-Rad IQ5 system for quantitative real-time PCR
Use of SYBR to monitor double-stranded DNA products
Gene-specific primers for the target genes and the internal control gene (β-actin)

controls

No positive or negative controls were explicitly mentioned in the provided information.

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!