Dual Reporter Latent HIV Reactivation

In addition to the green fluorescent protein (GFP) reporter virus that measures the number of cells in which the latent HIV provirus is successfully reactivated, we created a luciferase-expressing virus that measures overall levels of transcriptional reactivation of latent HIV. A fully infectious molecular clone of NL4-3 expressing firefly luciferase from the native LTR was prepared, essentially as described below,for the replication-defective pseudotyping vector pNL-Luc-E⁻R⁻. Both pNL-Luc-E⁻R⁻ and the fully infectious molecular clone, pNL4-3, were obtained from the AIDS Research and Reference Reagent Program. pNL-Luc-E⁻R⁻ was originally generated by transposition of the firefly luciferase gene from the molecular clone pHXB-Luc [28] (link) into pNL4-3 between the BamHI (nt 8021) and XhoI sites (nt 8443) within the nef coding region [29] (link). The BamHI-XhoI fragment of pNL-Luc-E⁻R⁻ was shuttled into pNL4-3 to yield an env+/vpr+ vector that, when transfected, produces viruses capable of multiple rounds of infection and luciferase driven from the viral LTR. We also prepared an HIV dual reporter vector expressing mCherry and luciferase to simultaneously measure the number of cells containing reactivated latent provirus and the overall strength of the viral transcriptional response in these cells. To generate a fully infectious molecular clone expressing both of these reporters, firefly luciferase was inserted in place of the puromycin resistance gene in a modified pSicoR lentiviral expression vector termed pSicoRMS2 (a kind gift of Matt Spindler and Bruce Conklin, Gladstone Institute of Cardiovascular Disease). This vector contains an EF-1 alpha–driven mCherry:Puromycin cassette in which mCherry and puromycin are separated by a picornavirus-derived ribosomal skipping T2A sequence. The T2A sequence (ccccgggagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctcga) allows balanced production of the two flanking gene products [30] (link), [31] (link). The firefly luciferase gene was subcloned in place of puromycin with XmaI and EcoRI. Clones were then tested for mCherry and luciferase expression after transfection of 293T cells. Mcherry:T2A:luciferase was amplified using PCR primers containing 5′ and 3′ sequences from the pNLENG1 vector (NL4-3 GFP). This amplicon was digested with BamHI and SalI and inserted into the pNLENG1 vector backbone at the unique BamHI and XhoI sites. The XhoI site was destroyed in the cloning process, resulting in an S34C mutation in Nef.