SrtA-mCherry Fusion Expression in E. faecalis

E. faecalis OG1RFΔsrtA was transformed with plasmid pGCP123::PsrtA srtA‐2 L‐mCherry in which SrtA‐mCherry fusion is expressed on a plasmid and transcribed from the native srtA promoter. The wild‐type srtA native promoter was amplified using primers KpnI‐PsrtA‐F (5′‐ATCCGGTACCGCTTGTTTCTTTTACTTTAAAATTCCA‐3′) and XhoI‐PsrtA‐R (5′‐AAGCCTCGAGATTCTCCCTCCTTTTAATGT‐3′) and the srtA gene was amplified using primers XhoI‐SrtA‐F (5′‐GAATCTCGAGATGCGCCCAAAAGAGAAAAA‐3′) and EcoRI‐SrtA‐R (5′‐ATCCGAATTCAGCCACCCAATCGGCTAA3′), using E. faecalis OG1RF as template. mCherry was amplified using primers EcoRI‐SrtA‐R (5′‐ATCCGAATTCATGGTGAGCAAGGGC‐3′) and NotI‐STOP‐XbaI‐BamHI‐mCherry‐R (5′‐AATCGCGGCCGCCTATCTAGAGGATCCCTTGTACAGCTCGTCCAT‐3′). These three PCR products were ligated together using primer embedded restriction sites XhoI and EcoRI respectively. The resulting fusion product was cloned into PGCP123 (Nielsen et al., 2012 (link)) using primer embedded restriction sites KpnI and NotI. The expression and stability of the fusion was verified with anti‐mCherry (Invitrogen, USA) and anti‐SrtA (SABio, Singapore) immunoblotting of whole‐cell E. faecalis lysates.