FRA1 Knockdown and Overexpression

Two shRNAmirs targeting FRA1 (shFRA1 A: 5′ CCTGGTGCCAAGCATCAACA 3′ and shFRA1 B: 5′ TGGACAGTATCCCACATCCAAC 3′) were designed using the RNAi Codex database [49] (link) and cloned into the LMP retroviral vector (Open Biosystems). The LMP vector containing a non-silencing shRNA (shControl) was a gift from Dr Gretchen Poortinga. The pBABE-puro-FLAG-FRA1 construct was generated by PCR-mediated fusion of a FLAG epitope to the N-terminus of FRA1. The following antibodies were used in this study: anti-FRA1 (R-20; Santa Cruz Biotechnology), anti-FLAG M2 (Sigma-Aldrich), anti-14-3-3 (Santa Cruz Biotechnology), anti-vimentin (Cell Signalling Technology), anti-E-Cadherin (BD Transduction Laboratories), anti-ZO-1 (BD Transduction Laboratories), anti-14-3-3 (BD Transduction Laboratories) and anti-β-catenin (BD Transduction Laboratories).

Free full text: Click here

Diesch J., Sanij E., Gilan O., Love C., Tran H., Fleming N.I., Ellul J., Amalia M., Haviv I., Pearson R.B., Tulchinsky E., Mariadason J.M., Sieber O.M., Hannan R.D, & Dhillon A.S. (2014). Widespread FRA1-Dependent Control of Mesenchymal Transdifferentiation Programs in Colorectal Cancer Cells. PLoS ONE, 9(3), e88950.

Publication 2014

LMP retroviral vector anti-FRA1 (R-20; anti-FLAG M2 anti-14-3-3 anti-vimentin anti-E-Cadherin anti-ZO-1 anti-β-catenin

14 3 3 Antibodies Cadherin Epitope Retroviral Rnai Shrna Vector Vimentin β catenin

Corresponding Organization : University of Queensland

Top 5 similar protocols

Variable analysis

independent variables

ShFRA1 A: 5' CCTGGTGCCAAGCATCAACA 3'
ShFRA1 B: 5' TGGACAGTATCCCACATCCAAC 3'
PBABE-puro-FLAG-FRA1 construct

dependent variables

FRA1 protein expression
Expression of markers for epithelial-mesenchymal transition (EMT), such as vimentin, E-Cadherin, ZO-1, β-catenin

control variables

ShControl (non-silencing shRNA)

controls

Positive control: pBABE-puro-FLAG-FRA1 construct
Negative control: shControl (non-silencing shRNA)

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!