CRISPR-Cas9 Knockout Mouse Models

Whole body Bcl2l13 knockout mice were generated by the Karolinska Center for Transgene Technologies using the CrisprCAS9 system. Two guide RNAs (sgRNA1: TCCTCTACGACTGCGTCTCT, sgRNA2: CTGCAGTCCATGCCAGCGGA) targeting exon 2 and 5 of Bcl2l13, respectively, were injected alongside Cas9 protein into C57BL/6NCrl zygotes twice. Out of the 38 animals born, three animals carried deletions around the guide RNA targeting exon 5. Out of these 3 founder animals, the animal carrying a 108 bp deletion (g.34512_34619del, NCBI Gene ID: 94044; g.120847678_120847785del, NCBI Reference Sequence: NC_000072.6) was chosen to establish the Bcl2l13 knockout mouse line. The C5024T mice were generated previously [8 (link)]. Whole body Parkin knockout mice were obtained by crossing mice with Parkin exon 7 flanked by loxP-sites [37 (link)] to β-actin-cre transgenic mice [38 (link)] followed by backcrossing to C57BL/6NCrl mice (Charles River, Germany). Whole body Ulk1 and Ulk2 knockout mice were created by mating Ulk1^FL and Ulk2^FL mice (The Jackson Laboratory, stock number 017976 and 017977, respectively) to β-actin-cre transgenic mice [38 (link)] and subsequent backcrossing for 5 generations to C57BL/6NCrl mice (Charles River, Germany). Animals were housed in a 12-hours light/dark cycle in standard ventilated cages and fed ad libitum with a normal chow diet.