CRISPR/Cas9 Plasmid Generation for Gba1 and Ppt1 Genes

The SpCas9 (pX551) and single-guide RNA (sgRNA, pX552) expression plasmids developed by the Zhang lab (Swiech et al., 2015 (link)) were obtained from Addgene. To generate Gba1 and Ppt1 sgRNA, 20-nt target sequences were chosen using the CRISPR design tool (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design). sgRNA sequences were selected to precede a 5′-NGG protospacer-adjacent motif sequence and prioritized based on minimal off-target effects. The primers used to design the sgRNA targets are as follows: Gba1-1 (5′–3′) ACCCGTTACGAGAGCACTCGACG; Gba1-2 (5′–3′) ACCGGATAACTGGAAGTCGTTAG; Ppt1-1 (5′–3′) ACCTGTTAATGTCCAAGTCAACA; Ppt1-2 (5′–3′) ACCCCATGCCAGATCACCAGCGG. To generate sgRNA-expressing constructs, pX552 was digested using SapI Fast Digest (ThermoFisher Scientific, D1934) and annealed oligos were ligated using T7 DNA Ligase (NEB, M0318). Transformation was performed using One-Shot Stbl3 Chemically Competent Escherichia coli (Thermo, 737303). Following maxi prep (Qiagen, 12662), Sanger sequencing confirmed correct sgRNA insertion using the U6 promoter-sequencing primer (5′–3′) GAGGGCCTATTTCCCATGATTC.