Expressing Antibody Variable Regions as Multimers

Antibody variable regions were cloned into expression plasmids from In vivogen (#pfusess-hchg1, #pfuse2ss-hclk, #pfuse2ss-hcll2). The variable heavy and light chain regions were amplified from the linear expression cassettes (2 µl at 1 ng/µl) using 10 µl NEB Q5 Hot Start HiFi PCR master mix (#M0494S), 6 µl nuclease-free water and 1 µl sequence-specific F and R primer (10 µM, f/c 500 nM) that were based on the results of analysis using IMGT/VQUEST (38 (link)). These primers introduced restriction sites (EcoRI & NheI for hchg1, EcoRI & BsiWII for hclk, and EcoRI & AvrII for hcll2). Annealing temperatures were primer sequence dependent and were calculated using NEB’s Tm calculator to match the salt concentration in their buffer. In an attempt to express the variable regions from IgM⁺ B cells as a multimer (pentamer/hexamer mix) instead of a monomer, we modified the IgG₁ heavy chain expression plasmid (15 (link)). The IgM multimerization sequence PTLYNVSLVMSDTAGTCY (CCAACGCTCTATAATGTCTCTTTGGTTATGTCCGACACAGCCGGTACCTGCTAT) was cloned into the IgG₁ expression vector at the C-terminus of the open reading frame, immediately in front of the stop codon, and the leucine at position -139 relative to the proline in the multimerization sequence was changed into a cysteine. Every plasmid was Sanger sequence-verified prior to using it as expression vector.