Template DNA was amplified from impa2 cDNA clone K9 by PCR using forward primer 5´-GCGCGAATTAACCCTCACTAAAGGG CTCCCGAACAGATCGTCG-3´ (ntd 1483–1500 of GenBank accession no. BT003258) and reverse primer 5´- GCGCGAATTAACCCTCACTAAAGGG AATCATTCAAACAATTCATTATTTATTGACAACTTTG-3´ (complementary to ntd 2447–2483 of GenBank accession no. BT003258), both of which contain the promoter sequences for T3 RNA polymerase (shown in bold) at their 5´-ends. dsRNA was transcribed in vitro from the amplified DNA with T3 RNA polymerase (MEGAscript T3 kit, Ambion). dsRNA (0.1 nl of a 1.7 μg/μl solution) was injected into the posterior pole of pgc nos embryos at early stage 2. Because knockout of maternal impα2 mRNA results in developmental arrest at early cleavage stage [82 (link)], we performed partial knockdown of impα2 mRNA by precisely regulating the injection volume using a thin glass needle (hole diameter = 3 μm). Injected embryos were fixed in a 1:1 mixture of heptane and fixative II for 20 min, and the vitelline membrane was removed in PBS using a tungsten needle. Fixed embryos were processed for in situ hybridization with an antisense ftz RNA probe, as described above. The pole cells located within 30 μm of median section of confocal serial images were counted.
Free full text: Click here
