Verteporfin Modulates Schwann Cell Signaling

Primary cells were treated with 2 and 10 μM Verteporfin (Sigma SML0534). At 4 h after treatment, cells were stimulated with 20 ng μl⁻¹ neuregulin-1 β isoform (heregulin-β 1, R&D Systems). RNA was harvested at 24 h after treatment, and cDNA was analyzed by RT-qPCR using the following primers:
18S (Forward: cgccgctagaggtgaaattct, Reverse: cgaacctccgactttcgttct),
ErbB2 (Forward: aggtctggagggaacatcct, Reverse: tgggatgcatgtgtctcagt),
Cdc42 (Forward: gctctggagatgcgttcatag, Reverse: gaagcaatattggctgccttg),
Egr2 (Forward: gcactctgtggccctagaaca, Reverse: ggctgagatggctcgagaaa),
Sox10 (Forward: cgaattgggcaaggtcaaga, Reverse: caccgggaacttgtcatcgt),
Itga6 (Forward: cgagagatcaacgacgagaaac, Reverse: tctttcctacaccctcctctatg),
Dag1 (Forward: ctcccagggtgtttcagact, Reverse: tcagagcaaccaaggtgaca).
The S16 rat Schwann cell line ^{56 (link)} was obtained from Richard Quarles, cultured as described ^{52 (link)}, and expresses relatively high levels of myelin genes ^{25 (link)}.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Poitelon Y., Lopez-Anido C., Catignas K., Berti C., Palmisano M., Williamson C., Ameroso D., Abiko K., Hwang Y., Gregorieff A., Wrana J., Asmani M., Zhao R., Sim F., Wrabetz L., Svaren J, & Feltri M. (2016). YAP and TAZ control peripheral myelination and the expression of laminin receptors in Schwann cells. Nature neuroscience, 19(7), 879-887.

Publication 2016

Verteporfin heregulin-β 1

After treatment Cdc42 Cdna Cell line Cells Egr2 Erbb2 Genes Heregulin 1 Isoform Myelin Neuregulin 1 β Primers Sox10 Verteporfin

Corresponding Organization : University at Buffalo, State University of New York

Other organizations : University of Wisconsin–Madison, Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital

Top 5 similar protocols

Protocol cited in 1 other protocol

Variable analysis

independent variables

2 μM Verteporfin (Sigma SML0534)
10 μM Verteporfin (Sigma SML0534)

dependent variables

Expression of ErbB2
Expression of Cdc42
Expression of Egr2
Expression of Sox10
Expression of Itga6
Expression of Dag1

control variables

Treatment with 20 ng μl^-1 neuregulin-1 β isoform (heregulin-β 1, R&D Systems)
RNA harvest at 24 h after treatment
RT-qPCR analysis using the specified primers

controls

Positive control: S16 rat Schwann cell line, which expresses relatively high levels of myelin genes
No negative control specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!