PRDM9 Zinc Finger Array Genotyping

The PRDM9 zinc finger array was amplified by PCR in genomic DNA isolated from peripheral blood samples in EDTA. PCR was performed using PN0.6 F and PN2.5 R primers (PN0.6 F: TGAGGTTACCTAGTCTGGCA, PN2.5 R: ATAAGGGGTCAGCAGACTTC)33 (link), 3% DMSO and BioTaq (Bioline). Amplifications were performed as follows: 95 °C for 3 min; 45 cycles of 95 °C for 30 s, 62 °C for 30 s and 72 °C for 105 s. PCR products were purified with PCR DNA purification kit (Thermo Scientific) and subjected to bidirectional Sanger sequencing with the primers PN1.2 F and PN2.4 R (PN1.2 F: TGAATCCAGGGAACACAGGC and PN2.4 R: GCAAGTGTGTGGTGACCACA)33 (link) using BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems) on a ABI 3130XL Genetic Analyzer (Applied Biosystems).
In order to determine which PRDM9 alleles presented each subject, the zinc finger array sequences were aligned and compared to published data31 (link)33 (link)46 (link)59 (link).