MIWI CLIP-seq was performed as described40 (link). In brief, isolated round spermatids from adult C57BL/6J mice were UV-irradiated (254 nm) at 400 mj in a 15-cm plate before immunoprecipitation using a highly specific anti-MIWI antibody. Immunoprecipitated RNA-protein complexes were digested with micrococcal nuclease, labeled with [g-32P]-ATP (PerkinElmer) by T4 PNK (Fermentas), and isolated by SDS-PAGE, from which [32P]-labeled RNA-protein bands were cut for extracting RNAs for linker ligation, PCR amplification, and deep sequencing.
For each read, the first 4 random index sequences were removed and appended to the read name. The resulting read was 36 nt in length. The 3′-adaptor sequence (CTCGTATGCCGTCTTCTGCTTG) was trimmed and short reads (< 16 nt) were filtered out. Reads were then mapped to the mouse genome (mm9) using bowtie37 with parameters: “-l25 -n2 -k101 -m100 -e200 --best --strata --sam --phred33-quals”. Mapped reads with ≤ 1 mismatch were chosen for downstream analysis. Reads with lengths of 25-33 nt were classified as piRNAs, and longer reads are considered as MIWI targets.
For each read, the first 4 random index sequences were removed and appended to the read name. The resulting read was 36 nt in length. The 3′-adaptor sequence (CTCGTATGCCGTCTTCTGCTTG) was trimmed and short reads (< 16 nt) were filtered out. Reads were then mapped to the mouse genome (mm9) using bowtie37 with parameters: “-l25 -n2 -k101 -m100 -e200 --best --strata --sam --phred33-quals”. Mapped reads with ≤ 1 mismatch were chosen for downstream analysis. Reads with lengths of 25-33 nt were classified as piRNAs, and longer reads are considered as MIWI targets.
