For each read, the first 4 random index sequences were removed and appended to the read name. The resulting read was 36 nt in length. The 3′-adaptor sequence (CTCGTATGCCGTCTTCTGCTTG) was trimmed and short reads (< 16 nt) were filtered out. Reads were then mapped to the mouse genome (mm9) using bowtie37 with parameters: “-l25 -n2 -k101 -m100 -e200 --best --strata --sam --phred33-quals”. Mapped reads with ≤ 1 mismatch were chosen for downstream analysis. Reads with lengths of 25-33 nt were classified as piRNAs, and longer reads are considered as MIWI targets.
MIWI CLIP-seq for Spermatid piRNA Profiling
For each read, the first 4 random index sequences were removed and appended to the read name. The resulting read was 36 nt in length. The 3′-adaptor sequence (CTCGTATGCCGTCTTCTGCTTG) was trimmed and short reads (< 16 nt) were filtered out. Reads were then mapped to the mouse genome (mm9) using bowtie37 with parameters: “-l25 -n2 -k101 -m100 -e200 --best --strata --sam --phred33-quals”. Mapped reads with ≤ 1 mismatch were chosen for downstream analysis. Reads with lengths of 25-33 nt were classified as piRNAs, and longer reads are considered as MIWI targets.
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : Institute of Zoology, Chinese Academy of Sciences, University of Chinese Academy of Sciences, Wuhan University, Institute of Biophysics, Shanghai Institutes for Biological Sciences, Center for Excellence in Molecular Cell Science
Protocol cited in 1 other protocol
Variable analysis
- UV irradiation of isolated round spermatids from adult C57BL/6J mice at 254 nm with 400 mj in a 15-cm plate
- Immunoprecipitated RNA-protein complexes
- [32P]-labeled RNA-protein bands extracted from SDS-PAGE
- Sequenced reads with lengths of 25-33 nt classified as piRNAs
- Sequenced reads with lengths longer than 33 nt considered as MIWI targets
- Adult C57BL/6J mice
- Antibody used for immunoprecipitation (a highly specific anti-MIWI antibody)
- Positive control: Not explicitly mentioned.
- Negative control: Not explicitly mentioned.
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!