ChIP-seq analysis of transcription factors

ChIP was carried out as described previously ^{25 (link), 57 (link)} with the following antibodies: goat IgG (Santa Cruz Biotechnology, sc-2028), Sox10 (R&D, AF2864), and Tead1 (BD Biosciences, 610923). Primers used included the following:
Tekt3 +7.8kb (Forward: aataccagcagatccggaagac, Reverse: ttgactcgttctcccaggtttt),
Itga6 −22.8kb (Forward: tgcttctgataagccccaac, Reverse: aagtcccagacacgtccttg),
Itga6 −20.6kb (Forward: tggaggcagaaggagaaaaa, Reverse: aggggcctgttaggaacact),
Itga6 −16.2kb (Forward: gacttgagctgtctgcatgg, Reverse: tggactgactaggcttccaca),
Itga6 −8.5kb (Forward: aaaagccaaacaaacccaga, Reverse: ggctagggcaagctaaggat),
Itga6 −7.8kb (Forward: tgcttttggtcatgtggttg, Reverse: accactggctagctcagcat),
Itga6 −165bp (Forward: tcgataaaacgccggagagt, Reverse: gtagctagcagccgctcaat),
Dag1 +3kb (Forward: atgaacccctcttcctgacc, Reverse: ccttgctgagactgtgctca),
Dag1 −36kb (Forward: ggatggaagactgaaaggcc, Reverse: ccctttccctctggtgtgag).

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Poitelon Y., Lopez-Anido C., Catignas K., Berti C., Palmisano M., Williamson C., Ameroso D., Abiko K., Hwang Y., Gregorieff A., Wrana J., Asmani M., Zhao R., Sim F., Wrabetz L., Svaren J, & Feltri M. (2016). YAP and TAZ control peripheral myelination and the expression of laminin receptors in Schwann cells. Nature neuroscience, 19(7), 879-887.

Publication 2016

Sox10 Tead1

Antibodies Chip Goat Primers Sox10

Corresponding Organization : University at Buffalo, State University of New York

Other organizations : University of Wisconsin–Madison, Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital

Top 5 similar protocols

Variable analysis

independent variables

Antibodies used for ChIP: goat IgG (Santa Cruz Biotechnology, sc-2028), Sox10 (R&D, AF2864), and Tead1 (BD Biosciences, 610923)

dependent variables

Enrichment of genomic regions around the following genes: Tekt3, Itga6, Dag1

control variables

ChIP protocol was carried out as described previously in references 25 and 57

controls

Positive control: None specified.
Negative control: Goat IgG (Santa Cruz Biotechnology, sc-2028)

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!