Testicular Cell Gene Expression Analysis

Isolated cells: Enzymatically isolated testicular cells and developed cells from in-vitro cultures were mixed with 250 μL of lysis buffer and 2-mercaptoethanol mixture (GenElute Total RNA Miniprep Kit; Sigma, St. Louis, USA). The lysates were frozen at −80 °C for later RNA extraction. The cDNA synthesis was performed according to the qScript cDNA Synthesis Kit (Quantabio, Beverly, MA 01915, USA), using random hexamers, and qPCR was performed using specific primers for each examined spermatogenesis marker: gfr-α (forward:CAGTTTTCGTCTGCTGAGGTTG; reverse: TTCTGCTCAAAGTGGCTCCAT; product size, 141 bp), VASA (forward: AGTATTCATGGTGATCGGGAGCAG; reverse: GCAACAAGAACTGGGCACTTTCCA; product size, 83 bp), CREM-1 (forward:TTCTTTCACGAAGACCCTCA; reverse: TGTTAGGTGGTGTCCCTTCT; product size, 138 bp), BOULE (forward: AACCCAACAAGTGGCCCAAGATAC; reverse: CTTTGGACACTCCAGCTCTGTCAT; product size, 163 bp), protamine (forward: TCCATCAAAACTCCTGCGTGA; reverse: AGGTGGCATTGTTCCTTAGCA; product size, 114 bp), ACROSIN (forward: TGTCCGTGGTTGCCAAGGATAACA; reverse: AATCCGGGTACCTGCTTGTGAGTT; product size, 149 bp), and the calibrator gene GAPDH (forward: ACCACAGTCCATGCCATCAC; reverse: CACCACCCTGTTGCTGTAGCC; product size, 450 bp). The qPCR reaction was performed following the 2 × qPCRBIO SyGreen Blue Mix Hi-ROX (PCR Biosystems Ltd., Aztec House, 397–405 Archway Road, London, UK) protocol and was performed using the LightCycler 96 real-time PCR machine (Roche, Roche Diagnostics Corporation, Roche CustomBiotech, Indianapolis, IN, USA). According to the manufacturer introductions for the SYBR Green dye, we ran a PCR profile including a three-step amplification program and subsequent melting, described as follows: preincubation 10 min at 95 °C, 40 cycles of 15 s at 95 °C, 15 s at 60 °C (all the primers were designed with this specific annealing temperature), and 10 s at 72 °C. Melting cycle: 10 s at 95 °C, 60 s at 65 °C, and 1 s at 97 °C. The PCR products were identified and distinguished using the generated melting curve. The “threshold cycle” (Ct) values, representing the cycle number at which the sample fluorescence rises statistically above the background and crossing points (CP) for each transcript were defined. The relative quantity of the gene expression was analyzed using the 2^−ΔΔCt method. The results were expressed as the fold of increase related to the GAPDH of the same examined sample.
The microscopy samples were observed with an Olympus IX70 microscope (Olympus, Novato, CA, USA). The digital images and signal intensity charts were prepared using Image-Pro Plus (Media Cybernetics, Bethesda, MD, USA), Microsoft Excel, and Adobe Photoshop 7.0 software.