Construction of pCI-3C Plasmid for 3C Protease Expression

For pCI-3C construction, a DNA fragment containing the hepatitis A virus 3C protease (3Cpro) gene with EcoRI and KpnI sites was generated by PCR using the primers GACTGAATTCGCCACCATGTCAACTCTAGAAATAGCAGG and CAACGGTACCTTACTGACTTTCAATTTTCTTATCAATG (Evrogen, Moscow, Russia), and pBI-EGFP-3C [11 (link)] as the template. The fragment was purified using a Cleanup Standard kit (Evrogen, Moscow, Russia), digested with EcoRI and KpnI enzymes (SibEnzyme, Novosibirsk, Russia) and cloned into pCI (Promega, Madison, WI, USA) digested with the same enzymes. Plasmid pCI-3Cmut was constructed in the same way except that pBI-EGFP-3Cmut [11 (link)] was the source of the 3Cmut gene encoding inactivated 3Cpro with the Cys172-Ala substitution; pCI-EGFP was constructed previously [13 (link)]. All plasmids were amplified in E. coli TG1 cells and purified using a Plasmid Miniprep kit (Evrogen, Moscow, Russia).