EFQO Assay for 5' Exonuclease Activity

The EFQO assay was performed as previously described in ref. ^{29 (link)}. Briefly, the assay uses fluorophore- and fluorescence-quencher-labeled oligonucleotides to assess the 5’ exonuclease activity at a pH of 5 (MES buffer). Used sequences with varying degrees of CpG-content include random reference sequence (/56-FAM/accatgatgttcctgatgctaagtatg*c*a*c*/3IABkFQ/, /56-FAM/accatgacgttcctgatgctaagtatg*c*a*c*/3IABkFQ/ and /56-FAM/accatgacgttcctgacgctaagtacg*c*a*c*/3IABkFQ/), the MT-ATP6 gene (/56-FAM/agccctggctgtatgcctaactgctaa*c*a*t*/3IABkFQ/, /56-FAM/agccctggccgtacgcctaaccgctaa*c*a*t*/3IABkFQ/ and /56-FAM/agccctggccgtatgcctaactgctaa*c*a*t*/3IABkFQ/) and the MT-ND4L gene (/56-FAM/agtctttgctgcctgtgaagcagtggt*g*g*g*/3IABkFQ/, /56-FAM/agtctttgccgcctgcgaagcagcggt*g*g*g*/3IABkFQ/, and /56-FAM/agtctttgctgcctgtgaagcagcggt*g*g*g*/3IABkFQ/). The * indicates a PTO bond, excluding 3’−5’ exonuclease activity. As 5’-Mod we used 6-Fam (qPCR probe) and at the 3’ end the Iowa Black FQ. Oligos were ordered from IDT. Fluorescent signals were acquired for a 12 h time-frame with 5 min intervals on a GloMax Multi Detection Plate Reader (Promega).