Fungi-Specific PCR Protocol using ITS1F and ITS2
Corresponding Organization : Swansea University
Other organizations : Centre for Environment, Fisheries and Aquaculture Science
Variable analysis
- Oligonucleotide primers (forward primer ITS1F CTTGGTCATTTAGAGGAAGTAA and reverse primer ITS2 GCTGCGTTCTTCATCGATGC)
- Amplicon size (320 bp)
- Reaction volume (25 μL)
- DNA concentration (ca. 50–200 ng/μL)
- Thermal cycler (BioRad T100 PCR thermal cycler)
- Cycling conditions (95 °C for 2 min, 30 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and 10 min elongation at 72 °C)
- Gel electrophoresis conditions (2% agarose/TBE gel with GreenSafe premium nucleic acid stain)
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!