Fungi-Specific PCR Protocol using ITS1F and ITS2

Fungi-specific PCR reactions were carried out using forward primer ITS1F CTTGGTCATTTAGAGGAAGTAA [28 (link)] and reverse primer ITS2 GCTGCGTTCTTCATCGATGC [29 ], producing amplicons of 320 bp using a protocol modified from [30 (link)]. PCR reactions were carried out in 25 μL total reaction volume using 2X Master Mix (New England Biolabs, Ipswich Massachusetts, MA, USA), 0.4 mM oligonucleotide primers synthesised by Eurofins (Ebersberg, Germany), 1 μL DNA (ca. 50–200 ng/μL) and performed on a BioRad T100 PCR thermal cycler. Cycling conditions were as follows: 95 °C for 2 min, followed by 30 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min and finalised by 10 min elongation at 72 °C. Products derived from PCR were visualised on a 2% agarose/TBE gel with GreenSafe premium nucleic acid stain (NZYTech, Portugal). Sanger sequencing was performed using both forward and reverse primers synthesised by Source BioScience (Nottingham, UK) and Eurofins. Sequences were deposited in GenBank under accession numbers MT000100-MT000103.