Genetic Constructs and Transfection Protocols

IRGM constructs were described previously ^{4 (link), 12 (link)–14 (link)}. Stx17
construct was a kind gift from N. Mizushima. MiTF and TFE3 constructs were from
R.Perera. TFEB constructs were kindly provided by R. Puertollano. Plasmid
constructs were verified by DNA-sequencing. Plasmids were transfected using
ProFection Mammalian Transfection System from Promega or Lipofectamine 2000
reagent from Thermo Fisher. All siRNAs were from Dharmacon. Cells were
transfected with 1.5 μg of siRNAs. For siRNA transfections 10⁶cells were resuspended in 100 μl of Nucleofector solution kit V (Amaxa),
siRNAs were then added to the cell suspension and cells were nucleoporated using
Amaxa Nucleofector apparatus with program D-032. Cells were re-transfected with
a second dose of siRNAs 24 h after the first transfection and assayed after 48
h. miRNA196 (sequence: UAGGUAGUUUCCUGUUGUUGGG) and miRNA20 (sequence:
UAAAGUGCUUAUAGUGCAGGUAG) were transfected with lipofectamine 2000 reagent. Cells
were assayed 48h after transfection.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Kumar S., Jain A., Choi S.W., da Silva G.P., Allers L., Mudd M.H., Peters R.S., Anonsen J.H., Rusten T.E., Lazarou M, & Deretic V. (2020). Mammalian Atg8 proteins and autophagy factor IRGM control mTOR and TFEB at a regulatory node critical for response to pathogens. Nature cell biology, 22(8), 973-985.

Publication 2020

Fection Mammalian Transfection System Lipofectamine 2000reagent Nucleofector solution kit V

Cells Lipofectamine Lipofectamine 2000 Mammalian Mitf Plasmids Promega Sirnas Tfe3 Tfeb Transfection

Corresponding Organization :

Other organizations : University of New Mexico, University of Oslo, Australian Regenerative Medicine Institute, Monash University

Top 5 similar protocols

Variable analysis

independent variables

IRGM constructs
Stx17 construct
MiTF and TFE3 constructs
TFEB constructs
SiRNAs
MiRNA196
MiRNA20

dependent variables

Measured outcomes

control variables

Plasmid constructs were verified by DNA-sequencing
Cells were transfected with 1.5 μg of siRNAs
Cells were re-transfected with a second dose of siRNAs 24 h after the first transfection and assayed after 48 h
MiRNA196 and miRNA20 were transfected with lipofectamine 2000 reagent. Cells were assayed 48h after transfection

controls

Positive control: Not explicitly mentioned
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!