Knockdown of lncRNA DLEU1 in CRC cells

CRC cell lines (LoVo, SW620, HCT116 and SW480) and normal cells HIEC were obtained from Cobioer (Nanjing, China) and followed their instructions to culture at 37°C. Sh-LncRNA DLEU1(sequence: CAACGGAAUGUAUCAAUGATT), sh-PRPS1(sequence: GCAGCTCCCACCAGGACTTAT), sh-NC(sequence: TTCTCCGAACGTGTCACGT), miR-320b mimics(sequence: AAAAGCUGGGUUGAGAGGGCAA), NC mimics(sequence: UUCUCCGAACGUGUCACGUTT), miR-320b inhibitors(sequence: UUGCCCUCUCAACCCAGCUUUU) and NC inhibitors(sequence: CAGUACUUUUGUGUAGUACAA) were obtained from RIBOBIO (Guangzhou, China). Cell transfection was conducted following the instruction of Lipofectamine 2000 (Invitrogen, CA, USA). Stably DLEU1-knockdown cell lines were screened out as previously reported (20 (link)). In brief, oligonucleotide for small hairpin RNA (shRNA) targeting DLEU1 was synthesized and inserted into the shRNA vector pGPH1/Neo (GenePharma, Shanghai, China). The DLEU1 shRNA vector was transfected into LoVo and SW480 cells with Lipofectamine 3000 (Invitrogen, CA, USA) and selected for 4 weeks with neomycin (1000 μg/ml). Scrambled shRNA (sh-NC) was applied as control. After culturing for 48 h, cells were utilized for follow-up study.