Knockdown of Zebrafish Cell Signaling Genes

Antisense morpholino oligonucleotides (MO) were obtained from GeneTools LLC and re-suspended in MilliQ H₂O to give a stock concentration of 1 mM and injected in one‐cell stage embryos. A Flaming/Brown micropipette puller was used to create micro-injection needles from borosilicate glass capillary tubes (0.5 mm inner diameter, Sutter). The PV800 Pneumatic PicoPump, as part of the micro-injection jig, was set up to release the required amount of injection material by adjusting the air pressure and air expulsion time. For the knockdown of cd9b two MOs were designed, a translation blocker with the following sequence (cd9b MO1): 5’-tttatgaggagaaacccaagactga-3’ and a splice site blocker (cd9b i2e3) with the following sequence: 5’-aacccctgaacacagagaaacaaca-3’, whilst the published mismatch MO was used 5’- tttccctgctgcttatacagcgatg -3’ [20 (link)]. For knockdown of cxcr4b and cxcl12a, the following sequences were used respectively, 5’-aatgatgctatcgtaaaattccat-3’and 5’-ttgagatccatgtttgcagtgtgaa-3’ [21 (link)].