Detecting 18 bp Deletion in PM19-A1

Detection of an 18 bp deletion on the promoter region of PM19-A1 was carried out using primers TaPM19-A1-5F (GAAACAGCTACCGTGTAAAGC) and TaPM19-A1-5R (TGGTGAAGTGGAGTGTAGTGG) reported by Barrero et al. (2015) (link). PCR reaction mixture contained template DNA, 2.5 mM MgCl₂, 1.5 mM dNTP, 1.5 μM of each primer, and 1 unit of Taq polymerase (NEB). The reaction mixture was made up to a total volume of 10 μl. The PCR conditions were as follows: 3 min at 94°C, followed by 30 cycles of 40 s at 94°C, 40 s at 60°C, and 1 min at 72°C. The last step was incubation for 7 min at 72°C. The PCR products were resolved on a 4% agarose gel and visualized with SYBR green I (Cambrex Bio Science, Rockland, ME, United States).